86
|
Ted Pella
carbon type b 400 mesh copper grid Carbon Type B 400 Mesh Copper Grid, supplied by Ted Pella, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cu+tem+grids+carbon+type-b+400+mesh+cu/400+copper+grid+mesh/pm28985469-148-0-9 Average 86 stars, based on 1 article reviews
carbon type b 400 mesh copper grid - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
86
|
Ted Pella
glow discharged carbon type b grids Glow Discharged Carbon Type B Grids, supplied by Ted Pella, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cu+tem+grids+carbon+type-b+400+mesh+cu/discharged+glow/bio_rxiv__64898__2025__12__30__697083-265-14-21 Average 86 stars, based on 1 article reviews
glow discharged carbon type b grids - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
94
|
MACHEREY NAGEL
glass beads Glass Beads, supplied by MACHEREY NAGEL, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cu+tem+grids+carbon+type-b+400+mesh+cu/MN+Bead+Tubes+Type+B/pmc06252066-47-73-81 Average 94 stars, based on 1 article reviews
glass beads - by Bioz Stars,
2026-09
94/100 stars
|
Buy from Supplier |
86
|
Ted Pella
mesh cu grids Mesh Cu Grids, supplied by Ted Pella, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cu+tem+grids+carbon+type-b+400+mesh+cu/cu+grids+mesh/pm26502636-59-32-37 Average 86 stars, based on 1 article reviews
mesh cu grids - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
90
|
Becton Dickinson
cyclin b antibody Cyclin B Antibody, supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cu+tem+grids+carbon+type-b+400+mesh+cu/anti+cyclin+b+monoclonal+antibody/pmc02582542-303-21-24 Average 90 stars, based on 1 article reviews
cyclin b antibody - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
86
|
Ted Pella
mesh carbon type b Mesh Carbon Type B, supplied by Ted Pella, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cu+tem+grids+carbon+type-b+400+mesh+cu/b+carbon+type+%E2%80%A2/mui_wilton__2017__development_and_applications_of_opposed_migration_aerosol_classifiers_omacs-4093-11-26 Average 86 stars, based on 1 article reviews
mesh carbon type b - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
86
|
Ted Pella
carbon coated copper grids Carbon Coated Copper Grids, supplied by Ted Pella, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cu+tem+grids+carbon+type-b+400+mesh+cu/copper+grids/10__1021_slash_acs__chemmater__7b04446____cm7b04446_si_001-75-8-12 Average 86 stars, based on 1 article reviews
carbon coated copper grids - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
90
|
Becton Dickinson
anti-cyclin b mouse antibody Anti Cyclin B Mouse Antibody, supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cu+tem+grids+carbon+type-b+400+mesh+cu/mouse+anti+cyclin+b/10__1074_slash_jbc__m114__581504-62-93-97 Average 90 stars, based on 1 article reviews
anti-cyclin b mouse antibody - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
86
|
Ted Pella
copper formvar tem grids Copper Formvar Tem Grids, supplied by Ted Pella, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cu+tem+grids+carbon+type-b+400+mesh+cu/grids+tem/10__1021_slash_acsearthspacechem__1c00237-40-4-13 Average 86 stars, based on 1 article reviews
copper formvar tem grids - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
93
|
Bio-Rad
east type b miyamotoi 2128 miya f acaaagatatatccttatca 227430 East Type B Miyamotoi 2128 Miya F Acaaagatatatccttatca 227430, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cu+tem+grids+carbon+type-b+400+mesh+cu/Lyphochek+Urine+Metals+Control/pm33956124-61-67-105 Average 93 stars, based on 1 article reviews
east type b miyamotoi 2128 miya f acaaagatatatccttatca 227430 - by Bioz Stars,
2026-09
93/100 stars
|
Buy from Supplier |
N/A
|
GPR37 untagged Human G protein coupled receptor 37 endothelin receptor type B like cDNA clone MGC 48831 IMAGE 5174678 complete cds
|
Buy from Supplier |